W056E05 - 04186



1 - 10: 9 9 9 4 4 4 9 9 6 8 GGGGAGGGGA 11 - 20: 9 9 9 4 4 4 6 6 4 4 AAAAAGGGTA 21 - 30: 4 4 4 6 6 6 6 8 6 5 NGCCTGTGCC 31 - 40: 5 5 6 6 6 6 6 4 4 4 AGTCGGCTAG 41 - 50: 6 6 4 4 4 6 6 6 6 4 CTTCTTGGTA 51 - 60: 4 4 4 4 8 8 10 10 11 11 CGNTTCTTCT 61 - 70: 19 20 14 14 17 8 4 4 4 6 TCTTTGTNAC 71 - 80: 8 10 11 12 13 12 11 10 18 9 GGGCCTGGGA 81 - 90: 9 11 11 11 10 8 8 8 8 13 CCTGATGCAT 91 - 100: 16 20 10 14 14 12 12 9 13 17 GGAGGAGAAA 101 - 110: 24 24 18 17 17 10 6 6 11 11 GGCCACACCT 111 - 120: 11 10 9 9 8 8 8 9 19 21 CCCCACACAT 121 - 130: 27 15 15 21 25 30 30 30 30 28 AGGCTGACTG 131 - 140: 28 28 28 27 27 26 30 30 27 28 CTATCTGACC 141 - 150: 22 18 18 23 23 25 26 34 34 23 TCTGCAGAGA 151 - 160: 18 8 8 10 23 28 34 36 36 36 GGTGGAAGGA 161 - 170: 49 49 36 36 34 33 28 28 21 18 GAGGACACCG 171 - 180: 4 4 4 4 14 13 17 13 17 12 TNNTTGCCAT 181 - 190: 4 4 4 17 16 20 20 22 4 4 TNACCTTAGN 191 - 200: 4 4 4 4 9 8 8 6 6 8 TGNATACCTG 201 - 210: 8 11 11 9 13 9 9 8 7 8 GCCTGCTAAA 211 - 220: 15 8 8 11 12 10 16 18 21 18 GACCACCACC 221 - 230: 13 8 8 6 6 8 8 10 9 9 ACCTCCCCTT 231 - 240: 23 9 9 9 9 4 8 9 17 15 TTCTCTCCAT 241 - 250: 15 9 4 4 4 8 10 8 10 12 TCANAGGGGG 251 - 260: 14 9 8 7 7 12 12 9 9 8 GGGGGCCCCC 261 - 270: 8 14 9 9 12 9 9 9 9 10 CCCCCCCCCC 271 - 280: 20 10 12 10 9 12 4 4 4 4 CCCCCCCNNN 281 - 290: 4 4 4 4 4 4 4 4 4 4 NNNNNNNCNA 291 - 300: 4 4 4 9 9 9 8 8 8 6 CNCAAAAACT 301 - 310: 6 7 4 7 10 8 7 7 7 10 TCTCTCCCCC 311 - 320: 6 6 9 13 13 14 13 12 7 7 CTCCCCCCCC 321 - 330: 10 7 8 9 4 4 4 4 4 4 TCGTGNANAN 331 - 340: 4 6 6 8 8 14 4 4 4 4 CCGCGGGNNN 341 - 350: 4 4 4 4 4 4 4 4 4 4 NNNNNNNNCN 351 - 360: 4 4 4 4 4 4 4 4 4 4 NNNNNNNANA 361 - 370: 4 4 4 4 10 10 13 14 17 21 NNACTTACCC 371 - 380: 31 27 18 14 9 4 4 4 4 10 CCCCCCNNCT 381 - 390: 8 8 6 6 11 12 10 6 8 6 CCCTCCCCAC 391 - 400: 6 8 8 9 9 8 8 8 9 8 AACCCCACAA 401 - 410: 8 4 4 8 8 8 9 9 11 12 CCGCTTGCCC 411 - 420: 6 6 6 6 8 11 17 13 12 10 CATCACCCAC 421 - 430: 14 7 6 4 4 6 6 12 10 15 CCCACACCCA 431 - 440: 12 13 9 10 8 8 8 6 6 8 CCCCCATCTC 441 - 450: 6 6 12 8 12 9 11 8 6 6 TCCCCCCTAC 451 - 460: 8 6 10 10 9 8 8 7 7 8 TCCCCCTCCT 461 - 470: 8 10 6 6 6 6 8 8 8 4 CCTCACCCTC 471 - 480: 6 6 8 9 8 8 6 6 8 6 TCTCCACTCA 481 - 490: 6 12 8 9 10 8 8 8 8 9 CCCATCGACC 491 - 500: 8 9 12 12 7 6 8 6 6 12 TCCCCCCATC 501 - 510: 10 6 6 8 15 21 28 25 17 11 CTCCCCCCCC 511 - 520: 8 6 6 8 8 8 8 8 8 8 CTCACCGCCT 521 - 530: 8 8 6 6 8 8 6 6 8 6 CCCACCACTC 531 - 540: 7 11 7 8 9 17 17 9 9 9 CCCCCCCCAC 541 - 550: 10 11 9 9 7 7 9 11 9 9 CCCAACTCCA 551 - 560: 9 13 12 12 8 8 7 8 8 6 CCCCCACTCC 561 - 570: 6 8 11 12 12 8 7 12 11 9 ACCCCCCCCC 571 - 580: 7 7 7 12 14 19 14 20 10 9 CCCCCCCCCC 581 - 590: 7 8 10 14 16 25 19 23 13 8 CCCCCCCCCG 591 - 600: 8 11 11 11 15 8 8 6 6 8 CTCCCCACAC 601 - 610: 8 6 6 12 10 8 8 8 10 12 CTCCCCAACC 611 - 620: 4 4 4 6 6 12 10 10 13 9 CTCGCCCCCC 621 - 630: 8 8 8 8 8 9 12 8 8 9 ACGCACCCCC 631 - 640: 18 12 14 10 9 9 9 10 8 11 CCTCCGTCCC 641 - 650: 6 6 8 12 9 9 9 9 9 9 TACCCACACC 651 - 660: 8 8 10 9 9 10 8 11 8 8 CCCAGTCCCA 661 - 670: 8 8 6 6 6 8 6 6 11 8 CCACCTACCT 671 - 680: 8 6 6 6 6 6 10 6 6 8 CAACGCCGCC 681 - 690: 8 10 20 16 16 10 7 12 9 9 CCCCCCCCCG 691 - 700: 9 8 8 6 6 10 8 13 10 12 CGCACCCCCC 701 - 710: 8 7 9 9 11 9 11 9 9 8 CGACGCCTCA 711 - 720: 10 11 14 13 11 9 6 6 6 6 CCCCCCACAC 721 - 730: 8 10 9 8 8 6 6 6 6 8 CCCACCCCAC 731 - 740: 8 6 6 11 8 11 11 12 11 9 TACACTCCCC 741 - 750: 9 8 8 7 7 13 14 23 14 10 TACACCCCCC 751 - 760: 10 9 9 9 12 14 19 18 9 7 ACTCCCTCCT 761 - 770: 7 6 10 6 6 8 8 11 11 9 CCCCGCCCCT 771 - 780: 9 11 9 9 9 9 14 12 12 9 CCCATCCCTC 781 - 790: 8 8 6 6 10 8 8 6 6 8 CGTCCTATCA 791 - 800: 10 8 4 4 8 8 8 6 6 9 CCGATCCCTT 801 - 810: 8 9 8 8 8 6 5 6 6 6 CACCCACCAC 811 - 820: 6 6 8 11 8 8 8 8 6 6 TCCACACCTT 821 - 830: 8 8 12 10 8 8 8 8 8 6 ACCCCCACCT 831 - 840: 7 10 11 10 11 9 9 8 9 9 CCCCACACAC 841 - 850: 10 9 9 6 6 6 6 8 8 7 ACACAACCCC 851 - 860: 7 10 8 8 6 6 14 6 7 7 CTCCACCCTC 861 - 870: 7 7 7 8 9 9 9 8 8 8 GCCCACCACA 871 - 880: 8 8 6 6 8 8 8 11 16 9 CACTACCCCC 881 - 890: 8 8 10 10 10 9 8 8 6 6 CCACCCGCCA 891 - 900: 8 6 6 10 8 10 10 10 12 10 CACCCACCCC 901 - 910: 8 8 8 8 8 6 6 6 8 8 TCCACCTGCC 911 - 920: 9 11 10 13 15 15 16 17 8 8 CCCCCCCTCA 921 - 930: 8 8 8 11 11 12 8 10 9 9 CTTCCTCCCT 931 - 940: 10 9 9 12 10 9 9 10 9 9 ACCACCCCAA 941 - 950: 9 23 21 18 11 9 9 7 7 10 CCCCCACCCA 951 - 960: 8 8 8 6 6 10 14 9 8 8 CATCTCCCTC 961 - 970: 10 8 10 6 6 8 8 7 7 7 ACCACCCCCC 971 - 980: 7 7 11 13 13 8 8 6 6 6 CCCCCCCTCT 981 - 990: 6 8 8 6 6 6 6 8 8 4 CCCTCCCCCA 991 - 994: 4 8 8 4 CCCA
RACE product (3' -> 5' orientation) >W056E05 - 04186 GGGGAGGGGAAAAAAGGGTANGCCTGTGCCAGTCGGCTAGCTTCTTGGTA CGNTTCTTCTTCTTTGTNACGGGCCTGGGACCTGATGCATGGAGGAGAAA GGCCACACCTCCCCACACATAGGCTGACTGCTATCTGACCTCTGCAGAGA GGTGGAAGGAGAGGACACCGTNNTTGCCATTNACCTTAGNTGNATACCTG GCCTGCTAAAGACCACCACCACCTCCCCTTTTCTCTCCATTCANAGGGGG GGGGGCCCCCCCCCCCCCCCCCCCCCCNNNNNNNNNNCNACNCAAAAACT TCTCTCCCCCCTCCCCCCCCTCGTGNANANCCGCGGGNNNNNNNNNNNCN NNNNNNNANANNACTTACCCCCCCCCNNCTCCCTCCCCACAACCCCACAA CCGCTTGCCCCATCACCCACCCCACACCCACCCCCATCTCTCCCCCCTAC TCCCCCTCCTCCTCACCCTCTCTCCACTCACCCATCGACCTCCCCCCATC CTCCCCCCCCCTCACCGCCTCCCACCACTCCCCCCCCCACCCCAACTCCA CCCCCACTCCACCCCCCCCCCCCCCCCCCCCCCCCCCCCGCTCCCCACAC CTCCCCAACCCTCGCCCCCCACGCACCCCCCCTCCGTCCCTACCCACACC CCCAGTCCCACCACCTACCTCAACGCCGCCCCCCCCCCCGCGCACCCCCC CGACGCCTCACCCCCCACACCCCACCCCACTACACTCCCCTACACCCCCC ACTCCCTCCTCCCCGCCCCTCCCATCCCTCCGTCCTATCACCGATCCCTT CACCCACCACTCCACACCTTACCCCCACCTCCCCACACACACACAACCCC CTCCACCCTCGCCCACCACACACTACCCCCCCACCCGCCACACCCACCCC TCCACCTGCCCCCCCCCTCACTTCCTCCCTACCACCCCAACCCCCACCCA CATCTCCCTCACCACCCCCCCCCCCCCTCTCCCTCCCCCACCCA
trapped sequence (5' -> 3' orientation) >W056E05 - 04186 GGTTGGGGTGGTAGGGAGGAAGTGAGGGGGGGGGCAGGTGGAGGGGTGGGTGTGGCGGGT GGGGGGGTAGTGTGTGGTGGGCGAGGGTGGAGGGGGTTGTGTGTGTGTGGGGAGGTGGGG GTAAGGTGTGGAGTGGTGGGTGAAGGGATCGGTGATAGGACGGAGGGATGGGAGGGGCGG GGAGGAGGGAGTGGGGGGTGTAGGGGAGTGTAGTGGGGTGGGGTGTGGGGGGTGAGGCGT CGGGGGGGTGCGCGGGGGGGGGGGCGGCGTTGAGGTAGGTGGTGGGACTGGGGGTGTGGG TAGGGACGGAGGGGGGGTGCGTGGGGGGCGAGGGTTGGGGAGGTGTGGGGAGCGGGGGGG GGGGGGGGGGGGGGGGGGGGGTGGAGTGGGGGTGGAGTTGGGGTGGGGGGGGGAGTGGTG GGAGGCGGTGAGGGGGGGGGAGGATGGGGGGAGGTCGATGGGTGAGTGGAGAGAGGGTGA GGAGGAGGGGGAGTAGGGGGGAGAGATGGGGGTGGGTGTGGGGTGGGTGATGGGGCAAGC GGTTGTGGGGTTGTGGGGAGGGAGNNGGGGGGGGGTAAGTNNTNTNNNNNNNNGNNNNNN NNNNNCCCGCGGNTNTNCACGAGGGGGGGGAGGGGGGAGAGAAGTTTTTGNGTNGNNNNN NNNNNGGGGGGGGGGGGGGGGGGGGGGCCCCCCCCCCTNTGAATGGAGAGAAAAGGGGAG GTGGTGGTGGTCTTTAGCAGGCCAGGTATNCANCTAAGGTNAATGGCAANNACGGTGTCC TCTCCTTCCACCTCTCTGCAGAGGTCAGATAGCAGTCAGCCTATGTGTGGGGAGGTGTGG CCTTTCTCCTCCATGCATCAGGTCCCAGGCCCGTNACAAAGAAGAAGAANC masked sequence (5' -> 3' orientation) >W056E05 - 04186 NGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNANNGGANNGGTNNTAGNNCGGAGGGATGGGAGNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNGAGNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNGGANNNNGGGGGGGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNGGGGGGGGNNGGGGGAGNGNNGTTTTTNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTGGTGGT GGTCTTTAGCAGGCCNNGTANNNNNNTAAGGNNNATGGCANNNNCGGTGTCCTCTCCTTC CACCTCTCTGCAGAGGTCAGATAGCAGTCAGCCTATGTGTGGGGAGNNGTGGCCTTTCTC CTCCATGCATCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN