W056E05 - 04186
Sequences producing significant alignments: Score E
(bits) Value
NM  |NM_007868.1|6681202| Mus musculus dystrophin, muscular dystro   96   2e-18
EST |CN672046.1|47438497| A0914C12-5 NIA Mouse Embryonic Stem (ES)   96   3e-17
EST |BE686274.1|10073898| uv80h06.x1 Soares mouse 3NbMS Mus muscul   96   3e-17
NT  |NT_039706.6|94407752|Mus musculus chromosome X genomic contig   96   4e-17
NR  |AL645477.8|20338482|Mouse DNA sequence from clone RP23-155L18   96   2e-16
NR  |AY326949.1|32966048|Rattus norvegicus dystrophin Dp71c (Dmd)    80   9e-12
NR  |AY326948.1|32966046|Rattus norvegicus dystrophin Dp71ab (Dmd)   80   9e-12
NR  |AY326947.1|32966044|Rattus norvegicus dystrophin Dp71a (Dmd)    80   9e-12
NR  |AF070485.1|3982750|Canis familiaris dystrophin mRNA, complete   74   6e-10
NR  |AJ865385.1|58416121|Sus scrofa mRNA for dystrophin variant Dp   72   2e-09
NM  |NM_000109.2|5032280| Homo sapiens dystrophin (muscular dystro   64   5e-09
NM  |NM_004023.1|5032312| Homo sapiens dystrophin (muscular dystro   64   5e-09
NM  |NM_004022.1|5032310| Homo sapiens dystrophin (muscular dystro   64   5e-09
NM  |NM_004021.1|5032308| Homo sapiens dystrophin (muscular dystro   64   5e-09
NM  |NM_004020.1|5032306| Homo sapiens dystrophin (muscular dystro   64   5e-09
NM  |NM_004015.1|5032296| Homo sapiens dystrophin (muscular dystro   64   5e-09
NM  |NM_004017.1|5032300| Homo sapiens dystrophin (muscular dystro   64   5e-09
NM  |NM_004018.1|5032302| Homo sapiens dystrophin (muscular dystro   64   5e-09
NM  |NM_004016.1|5032298| Homo sapiens dystrophin (muscular dystro   64   5e-09
NM  |NM_004012.1|5032290| Homo sapiens dystrophin (muscular dystro   64   5e-09
NM  |NM_004013.1|5032292| Homo sapiens dystrophin (muscular dystro   64   5e-09
NM  |NM_004014.1|5032294| Homo sapiens dystrophin (muscular dystro   64   5e-09
NM  |NM_004011.1|5032288| Homo sapiens dystrophin (muscular dystro   64   5e-09
NM  |NM_004009.1|5032286| Homo sapiens dystrophin (muscular dystro   64   5e-09
NM  |NM_004006.1|5032282| Homo sapiens dystrophin (muscular dystro   64   5e-09
NM  |NM_004007.1|5032284| Homo sapiens dystrophin (muscular dystro   64   5e-09
NM  |NM_004010.1|5032314| Homo sapiens dystrophin (muscular dystro   64   5e-09
NR  |AC078958.30|13435186|Homo sapiens X BAC RP11-609C15 (Roswell    64   6e-07
NR  |BC127103.1|119850916|Homo sapiens dystrophin (muscular dystro   64   6e-07
NR  |BC094758.1|63101667|Homo sapiens dystrophin (muscular dystrop   64   6e-07
NR  |BC070078.1|47123327|Homo sapiens dystrophin (muscular dystrop   64   6e-07
NR  |BC028720.1|20379675|Homo sapiens dystrophin (muscular dystrop   64   6e-07
NR  |AB208836.1|62087251|Homo sapiens mRNA for dystrophin Dp427c i   64   6e-07






















[ summary ]

>|NM_007868.1|6681202| Mus musculus dystrophin, muscular dystrophy
             (Dmd), mRNA
          Length = 13815

 Score = 95.6 bits (48), Expect = 2e-18
 Identities = 48/48 (100%)
 Strand = Plus / Plus

                                                             
Query: 830   tcctctccttccacctctctgcagaggtcagatagcagtcagcctatg 877
             ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 11033 tcctctccttccacctctctgcagaggtcagatagcagtcagcctatg 11080
























[ summary ]

>|CN672046.1|47438497| A0914C12-5 NIA Mouse Embryonic Stem (ES) cell
           (Lif+, 48 h, high density) cDNA library (Long) Mus
           musculus cDNA clone NIA:A0914C12 IMAGE:30768131 5', mRNA
           sequence
          Length = 596

 Score = 95.6 bits (48), Expect = 3e-17
 Identities = 48/48 (100%)
 Strand = Plus / Plus

                                                           
Query: 830 tcctctccttccacctctctgcagaggtcagatagcagtcagcctatg 877
           ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 49  tcctctccttccacctctctgcagaggtcagatagcagtcagcctatg 96
























[ summary ]

>|BE686274.1|10073898| uv80h06.x1 Soares mouse 3NbMS Mus musculus
           cDNA clone IMAGE:3413531 3' similar to gb:M18533
           DYSTROPHIN (HUMAN); gb:M68859 Mouse dystrophin mRNA,
           exons 1-7 and complete cds (MOUSE);, mRNA sequence
          Length = 661

 Score = 95.6 bits (48), Expect = 3e-17
 Identities = 48/48 (100%)
 Strand = Plus / Minus

                                                           
Query: 830 tcctctccttccacctctctgcagaggtcagatagcagtcagcctatg 877
           ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 329 tcctctccttccacctctctgcagaggtcagatagcagtcagcctatg 282
























[ summary ]

>|NT_039706.6|94407752|Mus musculus chromosome X genomic contig, strain
                C57BL/6J
          Length = 56119944

 Score = 95.6 bits (48), Expect = 4e-17
 Identities = 48/48 (100%)
 Strand = Plus / Plus

                                                                
Query: 830      tcctctccttccacctctctgcagaggtcagatagcagtcagcctatg 877
                ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 30124111 tcctctccttccacctctctgcagaggtcagatagcagtcagcctatg 30124158
























[ summary ]

>|AL645477.8|20338482|Mouse DNA sequence from clone RP23-155L18 on
             chromosome X, complete sequence.
          Length = 189131

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 48/48 (100%)
 Strand = Plus / Plus

                                                             
Query: 830   tcctctccttccacctctctgcagaggtcagatagcagtcagcctatg 877
             ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 90226 tcctctccttccacctctctgcagaggtcagatagcagtcagcctatg 90273
























[ summary ]

>|AY326949.1|32966048|Rattus norvegicus dystrophin Dp71c (Dmd) mRNA,
            complete cds; alternatively spliced.
          Length = 1567

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 46/48 (95%)
 Strand = Plus / Plus

                                                            
Query: 830  tcctctccttccacctctctgcagaggtcagatagcagtcagcctatg 877
            ||||||||||| ||||| ||||||||||||||||||||||||||||||
Sbjct: 1327 tcctctccttctacctcgctgcagaggtcagatagcagtcagcctatg 1374
























[ summary ]

>|AY326948.1|32966046|Rattus norvegicus dystrophin Dp71ab (Dmd) mRNA,
            complete cds; alternatively spliced.
          Length = 1914

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 46/48 (95%)
 Strand = Plus / Plus

                                                            
Query: 830  tcctctccttccacctctctgcagaggtcagatagcagtcagcctatg 877
            ||||||||||| ||||| ||||||||||||||||||||||||||||||
Sbjct: 1618 tcctctccttctacctcgctgcagaggtcagatagcagtcagcctatg 1665
























[ summary ]

>|AY326947.1|32966044|Rattus norvegicus dystrophin Dp71a (Dmd) mRNA,
            complete cds; alternatively spliced.
          Length = 1858

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 46/48 (95%)
 Strand = Plus / Plus

                                                            
Query: 830  tcctctccttccacctctctgcagaggtcagatagcagtcagcctatg 877
            ||||||||||| ||||| ||||||||||||||||||||||||||||||
Sbjct: 1618 tcctctccttctacctcgctgcagaggtcagatagcagtcagcctatg 1665
























[ summary ]

>|AF070485.1|3982750|Canis familiaris dystrophin mRNA, complete cds.
          Length = 13887

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 43/45 (95%)
 Strand = Plus / Plus

                                                          
Query: 833   tctccttccacctctctgcagaggtcagatagcagtcagcctatg 877
             |||||||| |||||||| |||||||||||||||||||||||||||
Sbjct: 11111 tctccttctacctctcttcagaggtcagatagcagtcagcctatg 11155
























[ summary ]

>|AJ865385.1|58416121|Sus scrofa mRNA for dystrophin variant Dp427 (dmd
             gene).
          Length = 11470

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Plus

                                                             
Query: 830   tcctctccttccacctctctgcagaggtcagatagcagtcagcctatg 877
             ||||||||||| |||||||| ||||||||||| |||||||||||||||
Sbjct: 10994 tcctctccttctacctctcttcagaggtcagacagcagtcagcctatg 11041
























[ summary ]

>|NM_000109.2|5032280| Homo sapiens dystrophin (muscular dystrophy,
             Duchenne and Becker types) (DMD), transcript variant
             Dp427c, mRNA
          Length = 14069

 Score = 63.9 bits (32), Expect = 5e-09
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                             
Query: 830   tcctctccttccacctctctgcagaggtcagatagcagtcagcctatg 877
             ||||||||||| |||||||| |||||||| || |||||||||||||||
Sbjct: 11154 tcctctccttctacctctctacagaggtccgacagcagtcagcctatg 11201
























[ summary ]

>|NM_004023.1|5032312| Homo sapiens dystrophin (muscular dystrophy,
            Duchenne and Becker types) (DMD), transcript variant
            Dp140bc, mRNA
          Length = 7048

 Score = 63.9 bits (32), Expect = 5e-09
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                            
Query: 830  tcctctccttccacctctctgcagaggtcagatagcagtcagcctatg 877
            ||||||||||| |||||||| |||||||| || |||||||||||||||
Sbjct: 4165 tcctctccttctacctctctacagaggtccgacagcagtcagcctatg 4212
























[ summary ]

>|NM_004022.1|5032310| Homo sapiens dystrophin (muscular dystrophy,
            Duchenne and Becker types) (DMD), transcript variant
            D140ab, mRNA
          Length = 7339

 Score = 63.9 bits (32), Expect = 5e-09
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                            
Query: 830  tcctctccttccacctctctgcagaggtcagatagcagtcagcctatg 877
            ||||||||||| |||||||| |||||||| || |||||||||||||||
Sbjct: 4456 tcctctccttctacctctctacagaggtccgacagcagtcagcctatg 4503
























[ summary ]

>|NM_004021.1|5032308| Homo sapiens dystrophin (muscular dystrophy,
            Duchenne and Becker types) (DMD), transcript variant
            Dp140b, mRNA
          Length = 7378

 Score = 63.9 bits (32), Expect = 5e-09
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                            
Query: 830  tcctctccttccacctctctgcagaggtcagatagcagtcagcctatg 877
            ||||||||||| |||||||| |||||||| || |||||||||||||||
Sbjct: 4495 tcctctccttctacctctctacagaggtccgacagcagtcagcctatg 4542
























[ summary ]

>|NM_004020.1|5032306| Homo sapiens dystrophin (muscular dystrophy,
            Duchenne and Becker types) (DMD), transcript variant
            Dp140c, mRNA
          Length = 7050

 Score = 63.9 bits (32), Expect = 5e-09
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                            
Query: 830  tcctctccttccacctctctgcagaggtcagatagcagtcagcctatg 877
            ||||||||||| |||||||| |||||||| || |||||||||||||||
Sbjct: 4135 tcctctccttctacctctctacagaggtccgacagcagtcagcctatg 4182
























[ summary ]

>|NM_004015.1|5032296| Homo sapiens dystrophin (muscular dystrophy,
            Duchenne and Becker types) (DMD), transcript variant
            Dp71, mRNA
          Length = 4623

 Score = 63.9 bits (32), Expect = 5e-09
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                            
Query: 830  tcctctccttccacctctctgcagaggtcagatagcagtcagcctatg 877
            ||||||||||| |||||||| |||||||| || |||||||||||||||
Sbjct: 1708 tcctctccttctacctctctacagaggtccgacagcagtcagcctatg 1755
























[ summary ]

>|NM_004017.1|5032300| Homo sapiens dystrophin (muscular dystrophy,
            Duchenne and Becker types) (DMD), transcript variant
            Dp71a, mRNA
          Length = 4584

 Score = 63.9 bits (32), Expect = 5e-09
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                            
Query: 830  tcctctccttccacctctctgcagaggtcagatagcagtcagcctatg 877
            ||||||||||| |||||||| |||||||| || |||||||||||||||
Sbjct: 1669 tcctctccttctacctctctacagaggtccgacagcagtcagcctatg 1716
























[ summary ]

>|NM_004018.1|5032302| Homo sapiens dystrophin (muscular dystrophy,
            Duchenne and Becker types) (DMD), transcript variant
            Dp71ab, mRNA
          Length = 4552

 Score = 63.9 bits (32), Expect = 5e-09
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                            
Query: 830  tcctctccttccacctctctgcagaggtcagatagcagtcagcctatg 877
            ||||||||||| |||||||| |||||||| || |||||||||||||||
Sbjct: 1669 tcctctccttctacctctctacagaggtccgacagcagtcagcctatg 1716
























[ summary ]

>|NM_004016.1|5032298| Homo sapiens dystrophin (muscular dystrophy,
            Duchenne and Becker types) (DMD), transcript variant
            Dp71b, mRNA
          Length = 4591

 Score = 63.9 bits (32), Expect = 5e-09
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                            
Query: 830  tcctctccttccacctctctgcagaggtcagatagcagtcagcctatg 877
            ||||||||||| |||||||| |||||||| || |||||||||||||||
Sbjct: 1708 tcctctccttctacctctctacagaggtccgacagcagtcagcctatg 1755
























[ summary ]

>|NM_004012.1|5032290| Homo sapiens dystrophin (muscular dystrophy,
            Duchenne and Becker types) (DMD), transcript variant
            Dp260-2, mRNA
          Length = 9916

 Score = 63.9 bits (32), Expect = 5e-09
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                            
Query: 830  tcctctccttccacctctctgcagaggtcagatagcagtcagcctatg 877
            ||||||||||| |||||||| |||||||| || |||||||||||||||
Sbjct: 7001 tcctctccttctacctctctacagaggtccgacagcagtcagcctatg 7048
























[ summary ]

>|NM_004013.1|5032292| Homo sapiens dystrophin (muscular dystrophy,
            Duchenne and Becker types) (DMD), transcript variant
            Dp140, mRNA
          Length = 7410

 Score = 63.9 bits (32), Expect = 5e-09
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                            
Query: 830  tcctctccttccacctctctgcagaggtcagatagcagtcagcctatg 877
            ||||||||||| |||||||| |||||||| || |||||||||||||||
Sbjct: 4495 tcctctccttctacctctctacagaggtccgacagcagtcagcctatg 4542
























[ summary ]

>|NM_004014.1|5032294| Homo sapiens dystrophin (muscular dystrophy,
            Duchenne and Becker types) (DMD), transcript variant
            Dp116, mRNA
          Length = 5623

 Score = 63.9 bits (32), Expect = 5e-09
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                            
Query: 830  tcctctccttccacctctctgcagaggtcagatagcagtcagcctatg 877
            ||||||||||| |||||||| |||||||| || |||||||||||||||
Sbjct: 2708 tcctctccttctacctctctacagaggtccgacagcagtcagcctatg 2755
























[ summary ]

>|NM_004011.1|5032288| Homo sapiens dystrophin (muscular dystrophy,
            Duchenne and Becker types) (DMD), transcript variant
            Dp260-1, mRNA
          Length = 9773

 Score = 63.9 bits (32), Expect = 5e-09
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                            
Query: 830  tcctctccttccacctctctgcagaggtcagatagcagtcagcctatg 877
            ||||||||||| |||||||| |||||||| || |||||||||||||||
Sbjct: 6858 tcctctccttctacctctctacagaggtccgacagcagtcagcctatg 6905
























[ summary ]

>|NM_004009.1|5032286| Homo sapiens dystrophin (muscular dystrophy,
             Duchenne and Becker types) (DMD), transcript variant
             Dp427p1, mRNA
          Length = 14000

 Score = 63.9 bits (32), Expect = 5e-09
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                             
Query: 830   tcctctccttccacctctctgcagaggtcagatagcagtcagcctatg 877
             ||||||||||| |||||||| |||||||| || |||||||||||||||
Sbjct: 11085 tcctctccttctacctctctacagaggtccgacagcagtcagcctatg 11132
























[ summary ]

>|NM_004006.1|5032282| Homo sapiens dystrophin (muscular dystrophy,
             Duchenne and Becker types) (DMD), transcript variant
             Dp427m, mRNA
          Length = 13993

 Score = 63.9 bits (32), Expect = 5e-09
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                             
Query: 830   tcctctccttccacctctctgcagaggtcagatagcagtcagcctatg 877
             ||||||||||| |||||||| |||||||| || |||||||||||||||
Sbjct: 11078 tcctctccttctacctctctacagaggtccgacagcagtcagcctatg 11125
























[ summary ]

>|NM_004007.1|5032284| Homo sapiens dystrophin (muscular dystrophy,
             Duchenne and Becker types) (DMD), transcript variant
             Dp427l, mRNA
          Length = 13764

 Score = 63.9 bits (32), Expect = 5e-09
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                             
Query: 830   tcctctccttccacctctctgcagaggtcagatagcagtcagcctatg 877
             ||||||||||| |||||||| |||||||| || |||||||||||||||
Sbjct: 10849 tcctctccttctacctctctacagaggtccgacagcagtcagcctatg 10896
























[ summary ]

>|NM_004010.1|5032314| Homo sapiens dystrophin (muscular dystrophy,
             Duchenne and Becker types) (DMD), transcript variant
             Dp427p2, mRNA
          Length = 14082

 Score = 63.9 bits (32), Expect = 5e-09
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                             
Query: 830   tcctctccttccacctctctgcagaggtcagatagcagtcagcctatg 877
             ||||||||||| |||||||| |||||||| || |||||||||||||||
Sbjct: 11167 tcctctccttctacctctctacagaggtccgacagcagtcagcctatg 11214
























[ summary ]

>|AC078958.30|13435186|Homo sapiens X BAC RP11-609C15 (Roswell Park
             Cancer Institute Human BAC Library) complete sequence.
          Length = 187547

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                             
Query: 830   tcctctccttccacctctctgcagaggtcagatagcagtcagcctatg 877
             ||||||||||| |||||||| |||||||| || |||||||||||||||
Sbjct: 18791 tcctctccttctacctctctacagaggtccgacagcagtcagcctatg 18744
























[ summary ]

>|BC127103.1|119850916|Homo sapiens dystrophin (muscular dystrophy,
            Duchenne and Becker types), mRNA (cDNA clone
            IMAGE:40124458), complete cds.
          Length = 4767

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                            
Query: 830  tcctctccttccacctctctgcagaggtcagatagcagtcagcctatg 877
            ||||||||||| |||||||| |||||||| || |||||||||||||||
Sbjct: 4019 tcctctccttctacctctctacagaggtccgacagcagtcagcctatg 4066
























[ summary ]

>|BC094758.1|63101667|Homo sapiens dystrophin (muscular dystrophy,
            Duchenne and Becker types), mRNA (cDNA clone
            IMAGE:30336570), complete cds.
          Length = 4621

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                            
Query: 830  tcctctccttccacctctctgcagaggtcagatagcagtcagcctatg 877
            ||||||||||| |||||||| |||||||| || |||||||||||||||
Sbjct: 1722 tcctctccttctacctctctacagaggtccgacagcagtcagcctatg 1769
























[ summary ]

>|BC070078.1|47123327|Homo sapiens dystrophin (muscular dystrophy,
            Duchenne and Becker types), mRNA (cDNA clone
            IMAGE:5262850), complete cds.
          Length = 4598

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                            
Query: 830  tcctctccttccacctctctgcagaggtcagatagcagtcagcctatg 877
            ||||||||||| |||||||| |||||||| || |||||||||||||||
Sbjct: 1670 tcctctccttctacctctctacagaggtccgacagcagtcagcctatg 1717
























[ summary ]

>|BC028720.1|20379675|Homo sapiens dystrophin (muscular dystrophy,
            Duchenne and Becker types), mRNA (cDNA clone
            IMAGE:4822807), complete cds.
          Length = 4658

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                            
Query: 830  tcctctccttccacctctctgcagaggtcagatagcagtcagcctatg 877
            ||||||||||| |||||||| |||||||| || |||||||||||||||
Sbjct: 1759 tcctctccttctacctctctacagaggtccgacagcagtcagcctatg 1806
























[ summary ]

>|AB208836.1|62087251|Homo sapiens mRNA for dystrophin Dp427c isoform
            variant protein.
          Length = 6801

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                            
Query: 830  tcctctccttccacctctctgcagaggtcagatagcagtcagcctatg 877
            ||||||||||| |||||||| |||||||| || |||||||||||||||
Sbjct: 3903 tcctctccttctacctctctacagaggtccgacagcagtcagcctatg 3950